ID: 1180204149_1180204155

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1180204149 1180204155
Species Human (GRCh38) Human (GRCh38)
Location 21:46246968-46246990 21:46247008-46247030
Sequence CCAAAGCTCTCCGTGCACTAAAT CAGGCCTCCAAGGGCACAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 64} {0: 1, 1: 1, 2: 4, 3: 26, 4: 283}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!