ID: 1180226796_1180226803

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1180226796 1180226803
Species Human (GRCh38) Human (GRCh38)
Location 21:46398305-46398327 21:46398339-46398361
Sequence CCCCTGCGCTCGCTGGGACTGTC TCGCTTTTCTTGCTCTTGTTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 95} {0: 1, 1: 0, 2: 2, 3: 27, 4: 419}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!