ID: 1180228621_1180228627

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1180228621 1180228627
Species Human (GRCh38) Human (GRCh38)
Location 21:46413139-46413161 21:46413156-46413178
Sequence CCCACCCGGGAGAGGCTGGACAC GGACACGCGGCAGCAAGGTGTGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 8, 4: 120} {0: 5, 1: 2, 2: 0, 3: 11, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!