ID: 1180228621_1180228631

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1180228621 1180228631
Species Human (GRCh38) Human (GRCh38)
Location 21:46413139-46413161 21:46413164-46413186
Sequence CCCACCCGGGAGAGGCTGGACAC GGCAGCAAGGTGTGGGGAGCGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 8, 4: 120} {0: 3, 1: 2, 2: 6, 3: 47, 4: 601}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!