ID: 1180228621_1180228636

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1180228621 1180228636
Species Human (GRCh38) Human (GRCh38)
Location 21:46413139-46413161 21:46413186-46413208
Sequence CCCACCCGGGAGAGGCTGGACAC GGAAGGCACGAGGCCCACCCGGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 1, 3: 8, 4: 120} {0: 4, 1: 0, 2: 1, 3: 19, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!