ID: 1180234572_1180234577

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1180234572 1180234577
Species Human (GRCh38) Human (GRCh38)
Location 21:46450011-46450033 21:46450043-46450065
Sequence CCCACCACAATCACCTCAAAAGC AAACTTTTAATGACTGCACCTGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!