ID: 1180235908_1180235932

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1180235908 1180235932
Species Human (GRCh38) Human (GRCh38)
Location 21:46459246-46459268 21:46459299-46459321
Sequence CCCCGCGACCCGCCCTCAGCCCG CCCGCGCGGCCCCTCACTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 259} {0: 1, 1: 2, 2: 3, 3: 24, 4: 260}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!