ID: 1180260234_1180260239

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1180260234 1180260239
Species Human (GRCh38) Human (GRCh38)
Location 21:46663370-46663392 21:46663420-46663442
Sequence CCCTGTCTTGCAGCACCACACAC GACCCAGTCCCTGTCCATACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 181} {0: 1, 1: 0, 2: 0, 3: 5, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!