ID: 1180260263_1180260277

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1180260263 1180260277
Species Human (GRCh38) Human (GRCh38)
Location 21:46663582-46663604 21:46663632-46663654
Sequence CCTGTGGGTGCCGGTCCTCAGGG GCAGATGCTGGCCCACACTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 152} {0: 1, 1: 0, 2: 2, 3: 25, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!