ID: 1180295318_1180295319

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1180295318 1180295319
Species Human (GRCh38) Human (GRCh38)
Location 22:10928987-10929009 22:10929012-10929034
Sequence CCTTCACTCTTCTAGAAGGACTT TTTGATAGTTCCTTTTTCCATGG
Strand - +
Off-target summary {0: 8, 1: 15, 2: 25, 3: 70, 4: 261} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!