ID: 1180297964_1180297974

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1180297964 1180297974
Species Human (GRCh38) Human (GRCh38)
Location 22:10961660-10961682 22:10961709-10961731
Sequence CCGAGGCGCCGGTGCTGGCGGTG CGGCCTCCCGCTAGAGCTGCGGG
Strand - +
Off-target summary No data {0: 1, 1: 6, 2: 1, 3: 5, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!