ID: 1180329242_1180329245

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1180329242 1180329245
Species Human (GRCh38) Human (GRCh38)
Location 22:11461668-11461690 22:11461700-11461722
Sequence CCTATGTGAGGGACAGTCAGACC ATGTTATGGAATCCTATTTGAGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 40, 3: 64, 4: 345} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!