ID: 1180344718_1180344721

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1180344718 1180344721
Species Human (GRCh38) Human (GRCh38)
Location 22:11697616-11697638 22:11697637-11697659
Sequence CCACATCTCTGGTGAGGAGCTGC GCCCCTTGGGTCTGAGTTTCTGG
Strand - +
Off-target summary {0: 5, 1: 29, 2: 8, 3: 58, 4: 201} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!