ID: 1180364358_1180364367

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1180364358 1180364367
Species Human (GRCh38) Human (GRCh38)
Location 22:11925586-11925608 22:11925631-11925653
Sequence CCAGAATGGTTCTGTAAGCAGGC TGTACAGGACCTCCCAAATGGGG
Strand - +
Off-target summary {0: 2, 1: 11, 2: 12, 3: 13, 4: 222} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!