ID: 1180392598_1180392601

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1180392598 1180392601
Species Human (GRCh38) Human (GRCh38)
Location 22:12298274-12298296 22:12298287-12298309
Sequence CCAGTCAGACAGGTGATGTGCTT TGATGTGCTTGGTGTGAGCTGGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!