ID: 1180408015_1180408016

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1180408015 1180408016
Species Human (GRCh38) Human (GRCh38)
Location 22:12574719-12574741 22:12574743-12574765
Sequence CCTGAATGTCTATTTAAACTTTA CTCTGCAAATAAAATAAAGTTGG
Strand - +
Off-target summary {0: 2, 1: 4, 2: 7, 3: 26, 4: 355} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!