ID: 1180460023_1180460033

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 1180460023 1180460033
Species Human (GRCh38) Human (GRCh38)
Location 22:15554001-15554023 22:15554024-15554046
Sequence CCGGGCTCAGTCTTCCTCCCCCT GGGCGAGGCGAGCACAGGCCTGG
Strand - +
Off-target summary {0: 3, 1: 2, 2: 3, 3: 53, 4: 621} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!