ID: 1180473618_1180473620

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1180473618 1180473620
Species Human (GRCh38) Human (GRCh38)
Location 22:15684365-15684387 22:15684387-15684409
Sequence CCAGGCTACTTCTGCATTTTCTA AACTTGTCTAGGTGAAAGCTAGG
Strand - +
Off-target summary No data {0: 4, 1: 0, 2: 0, 3: 4, 4: 103}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!