ID: 1180497333_1180497337

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1180497333 1180497337
Species Human (GRCh38) Human (GRCh38)
Location 22:15902377-15902399 22:15902399-15902421
Sequence CCACTGGCCACTGCCTGCCGCAG GCCCTGCCTCACAGCCTCAAAGG
Strand - +
Off-target summary {0: 6, 1: 3, 2: 8, 3: 29, 4: 450} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!