ID: 1180538707_1180538709

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1180538707 1180538709
Species Human (GRCh38) Human (GRCh38)
Location 22:16421144-16421166 22:16421172-16421194
Sequence CCAGCATGAGAAGGTAATATATT GTTCTAAGTGTATGACAATCTGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 4, 3: 7, 4: 173} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!