ID: 1180542164_1180542169

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1180542164 1180542169
Species Human (GRCh38) Human (GRCh38)
Location 22:16459506-16459528 22:16459551-16459573
Sequence CCCAGCTCTGTATGTTTATGTTG GTTTATTAGGATGGCCAAAAAGG
Strand - +
Off-target summary {0: 5, 1: 5, 2: 0, 3: 18, 4: 234} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!