ID: 1180587036_1180587041

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1180587036 1180587041
Species Human (GRCh38) Human (GRCh38)
Location 22:16901882-16901904 22:16901929-16901951
Sequence CCACAAAAGCCCAGTATAGGACA AGTTAACTGGAGAAGATGACCGG
Strand - +
Off-target summary No data {0: 12, 1: 1, 2: 31, 3: 245, 4: 333}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!