ID: 1180599546_1180599551

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1180599546 1180599551
Species Human (GRCh38) Human (GRCh38)
Location 22:17007396-17007418 22:17007411-17007433
Sequence CCGGGAGTGGCGGGTGAGGAGGG GAGGAGGGAAGGGGAGCGAGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 43, 3: 565, 4: 4040}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!