ID: 1180613240_1180613248

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1180613240 1180613248
Species Human (GRCh38) Human (GRCh38)
Location 22:17110964-17110986 22:17111010-17111032
Sequence CCAGCAAGGAAGCAGTTTGTGGG TGAGCTTGTCAGGGAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 122} {0: 1, 1: 0, 2: 1, 3: 18, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!