ID: 1180649939_1180649950

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1180649939 1180649950
Species Human (GRCh38) Human (GRCh38)
Location 22:17369451-17369473 22:17369476-17369498
Sequence CCTAGCCCCATCTGTTTCTCCGG GGGACTCGATTATATTGTAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 194} {0: 1, 1: 0, 2: 0, 3: 3, 4: 31}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!