ID: 1180649992_1180650003

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 1180649992 1180650003
Species Human (GRCh38) Human (GRCh38)
Location 22:17369617-17369639 22:17369665-17369687
Sequence CCCGCCCTCGGCTCCTGCACTCG GCGCCCCGCCGCCCCCGCCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 271} {0: 1, 1: 0, 2: 18, 3: 107, 4: 597}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!