ID: 1180675067_1180675082

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1180675067 1180675082
Species Human (GRCh38) Human (GRCh38)
Location 22:17581196-17581218 22:17581239-17581261
Sequence CCCGGGGGAGGGATGGGGCCCCC GCGCGCGTGAGCCTGGGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 46, 4: 511} {0: 1, 1: 0, 2: 2, 3: 23, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!