ID: 1180675069_1180675081

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1180675069 1180675081
Species Human (GRCh38) Human (GRCh38)
Location 22:17581214-17581236 22:17581235-17581257
Sequence CCCCCTTCCCTCCAGTCTCCAGG GGCAGCGCGCGTGAGCCTGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 12, 3: 107, 4: 890} {0: 1, 1: 0, 2: 2, 3: 16, 4: 167}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!