ID: 1180707383_1180707392

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1180707383 1180707392
Species Human (GRCh38) Human (GRCh38)
Location 22:17817960-17817982 22:17817973-17817995
Sequence CCTCCCGTTCTCCTTGGCCAGGG TTGGCCAGGGGCGGGTGGCGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 202} {0: 1, 1: 0, 2: 4, 3: 38, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!