ID: 1180719486_1180719492

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1180719486 1180719492
Species Human (GRCh38) Human (GRCh38)
Location 22:17896777-17896799 22:17896817-17896839
Sequence CCCGCACCAAGGCGGCGTTCTCG GAAGTCAAACATGGCCACATCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 37} {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!