ID: 1180733762_1180733779

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1180733762 1180733779
Species Human (GRCh38) Human (GRCh38)
Location 22:18001038-18001060 22:18001088-18001110
Sequence CCCGCGCTTCCCCGCGCCTGCTG CCTGGCCACGCATCCTCCGGCGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 2, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!