ID: 1180733782_1180733792

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1180733782 1180733792
Species Human (GRCh38) Human (GRCh38)
Location 22:18001093-18001115 22:18001119-18001141
Sequence CCACGCATCCTCCGGCGGGAGGT CACACGGGAACGCGAGGCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64} {0: 1, 1: 0, 2: 2, 3: 4, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!