ID: 1180736942_1180736946

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 1180736942 1180736946
Species Human (GRCh38) Human (GRCh38)
Location 22:18024389-18024411 22:18024402-18024424
Sequence CCTGCAGCTGCGATCCCGCCCAG TCCCGCCCAGTTAGCCTCGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152} {0: 1, 1: 0, 2: 0, 3: 1, 4: 51}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!