ID: 1180736942_1180736959

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1180736942 1180736959
Species Human (GRCh38) Human (GRCh38)
Location 22:18024389-18024411 22:18024438-18024460
Sequence CCTGCAGCTGCGATCCCGCCCAG CCCCCTCGCCCAGGGCCCAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 152} {0: 1, 1: 0, 2: 3, 3: 44, 4: 413}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!