ID: 1180754353_1180754368

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1180754353 1180754368
Species Human (GRCh38) Human (GRCh38)
Location 22:18150069-18150091 22:18150118-18150140
Sequence CCATTCAGTGGAAAACGAAAGCT AGACCAAGGCGGGCCCGGAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 150} {0: 1, 1: 0, 2: 0, 3: 22, 4: 151}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!