ID: 1180756027_1180756031

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1180756027 1180756031
Species Human (GRCh38) Human (GRCh38)
Location 22:18161833-18161855 22:18161855-18161877
Sequence CCTTTCCAGATGCTTCTGCTGCT TGGAGAAGATGCAGGACAGCCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 4, 3: 49, 4: 506} {0: 2, 1: 0, 2: 6, 3: 50, 4: 433}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!