ID: 1180762899_1180762909

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1180762899 1180762909
Species Human (GRCh38) Human (GRCh38)
Location 22:18222844-18222866 22:18222877-18222899
Sequence CCAGGAAGAAACCCCCCAGTGTC GGGCCGAGAGGACGAAGCCTCGG
Strand - +
Off-target summary No data {0: 2, 1: 4, 2: 1, 3: 13, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!