ID: 1180784528_1180784531

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1180784528 1180784531
Species Human (GRCh38) Human (GRCh38)
Location 22:18539432-18539454 22:18539449-18539471
Sequence CCCCAGCAATCTTGGGGATCACT ATCACTTCTTCAAAACCCCAAGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 0, 3: 17, 4: 181}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!