ID: 1180799784_1180799796

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1180799784 1180799796
Species Human (GRCh38) Human (GRCh38)
Location 22:18626355-18626377 22:18626406-18626428
Sequence CCCAGCTGCAGCTTCTCAAGGTG GGGAGTCAGAGCTGGCCCCAGGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 3, 3: 52, 4: 397}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!