ID: 1180800005_1180800015

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1180800005 1180800015
Species Human (GRCh38) Human (GRCh38)
Location 22:18627308-18627330 22:18627332-18627354
Sequence CCATGGGAGGTCCCAGGGGCCAG AGGGCCCCTGTGGTGCTGGGAGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 4, 3: 36, 4: 370}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!