ID: 1180803168_1180803173

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1180803168 1180803173
Species Human (GRCh38) Human (GRCh38)
Location 22:18643082-18643104 22:18643118-18643140
Sequence CCTCTAGAAGATTATCAGTGGAT CCCTGCAGGCCAGAAGGTGGTGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 7, 3: 38, 4: 168} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!