ID: 1180806649_1180806659

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1180806649 1180806659
Species Human (GRCh38) Human (GRCh38)
Location 22:18718158-18718180 22:18718191-18718213
Sequence CCAGGAAGAAACCCCCCAGTGTC GGGCCGAGAGGACGAAGCCCCGG
Strand - +
Off-target summary {0: 6, 1: 0, 2: 2, 3: 8, 4: 147} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!