|
Left Crispr |
Right Crispr |
| Crispr ID |
1180823582 |
1180823586 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
22:18848122-18848144
|
22:18848147-18848169
|
| Sequence |
CCTTCACATTTCTGGGCCTCAGC |
CAGCTGCAGCAGGTGCCCAGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 14, 1: 25, 2: 11, 3: 102, 4: 614} |
{0: 18, 1: 16, 2: 13, 3: 55, 4: 481} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|