ID: 1180831078_1180831093

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1180831078 1180831093
Species Human (GRCh38) Human (GRCh38)
Location 22:18906440-18906462 22:18906486-18906508
Sequence CCAGCTGCTGTCGGCGTTACAGA TACGCGGGCGGGGCGGGCGGCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 3, 4: 47} {0: 2, 1: 1, 2: 2, 3: 62, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!