ID: 1180834071_1180834078

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1180834071 1180834078
Species Human (GRCh38) Human (GRCh38)
Location 22:18921092-18921114 22:18921110-18921132
Sequence CCAGACCCCCTCTCCTTGTGGTG TGGTGTCTTAAGGCTCCGCGTGG
Strand - +
Off-target summary No data {0: 2, 1: 1, 2: 0, 3: 2, 4: 35}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!