ID: 1180876707_1180876712

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1180876707 1180876712
Species Human (GRCh38) Human (GRCh38)
Location 22:19178273-19178295 22:19178290-19178312
Sequence CCGCCCGGCCGCTGGCGCTCGGG CTCGGGCCCCTCCCCCGTCCCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 16, 4: 154} {0: 1, 1: 0, 2: 4, 3: 33, 4: 367}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!