ID: 1180876710_1180876715

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1180876710 1180876715
Species Human (GRCh38) Human (GRCh38)
Location 22:19178277-19178299 22:19178297-19178319
Sequence CCGGCCGCTGGCGCTCGGGCCCC CCCTCCCCCGTCCCGGACTTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 278} {0: 1, 1: 0, 2: 0, 3: 15, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!