ID: 1180876721_1180876730

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1180876721 1180876730
Species Human (GRCh38) Human (GRCh38)
Location 22:19178304-19178326 22:19178336-19178358
Sequence CCGTCCCGGACTTCGGTCGGCGC GCCAGTGCCGCGGGGAACATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22} {0: 1, 1: 0, 2: 1, 3: 2, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!