ID: 1180883802_1180883810

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1180883802 1180883810
Species Human (GRCh38) Human (GRCh38)
Location 22:19225322-19225344 22:19225354-19225376
Sequence CCCAAGGCAGCCAGTGCTGCATC TTTGCAGGAAGGCCGTCTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 21, 4: 219} {0: 1, 1: 0, 2: 0, 3: 6, 4: 75}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!