ID: 1180887574_1180887577

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1180887574 1180887577
Species Human (GRCh38) Human (GRCh38)
Location 22:19258046-19258068 22:19258061-19258083
Sequence CCAGTTTGTGAGGAGCGACATCC CGACATCCATGGGCTCTGCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 71} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!